HUGE

Gene/Protein Characteristic Table for KIAA1290

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Mapping

Product ID :	ORK00798
Accession No. :	AB033116
Description :	oxoglutarate dehydrogenase-like.
HUGO Gene Name :
Clone Name :	hj00086s2 [Vector Info]
Flexi ORF Clone :	pF1KSDA1290
Source :	Human adult brain
Note :	We replaced hj00086 and hj00086s1, former representative clones for KIAA1290 with hj00086s2. (2002/12/27,2003/4/2)

Features of the cloned DNA sequence	Description

Length: 3622 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 584 bp

Genome contig ID gi89161187r_50512696
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
ACCAAATCACAGAGAAATAAAAACATGCTTCAGAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGATTTGCTGTTTTCATTTCATGTTGTAAAACTGGGGGAGGGATAGGCAG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 10 r 50612696 50636649 22 99.7 Perfect prediction

Features of the protein sequence	Description

Length: 1011 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9ULD0	100.0	2-oxoglutarate ...	Homo sapiens
BAF82915	99.9	unnamed protein...	Homo sapiens
BAA91855	99.8	unnamed protein...	Homo sapiens
AAH26320	99.8	Oxoglutarate de...	Homo sapiens
CAH91542	98.9	hypothetical pr...	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB046850	6.8e-88	39.7	KIAA1630

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001017 244 570 PF00676 Dehydrogenase

IPR005475 637 853 PF02779 Transketolase

HMMTigr IPR011603 44 1001 TIGR00239 2-oxoglutarate dehydrogenase

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001017	244	570	PF00676	Dehydrogenase
IPR005475	637	853	PF02779	Transketolase
HMMTigr	IPR011603	44	1001	TIGR00239	2-oxoglutarate dehydrogenase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

RH mapping information	Description

Chromosome No.

: 10

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CGGCTTCTCCACCTGTATCTC
Primer_r	: GCTTCACCTGGCTGTTACTGC
PCR product length	: 175 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	584 bp
Genome contig ID	gi89161187r_50512696
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- ACCAAATCACAGAGAAATAAAAACATGCTTCAGAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGATTTGCTGTTTTCATTTCATGTTGTAAAACTGGGGGAGGGATAGGCAG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	10	r	50612696	50636649	22	99.7	Perfect prediction

Gene/Protein Characteristic Table for KIAA1290

Features of the cloned DNA sequence

Features of the protein sequence

RH mapping information