HUGE |
Gene/Protein Characteristic Table for KIAA1295 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK06818 |
---|---|
Accession No. : | AB037716 |
Description : | SH3 and PX domains 2B. |
HUGO Gene Name : | |
Clone Name : | fg01760 [Vector Info] |
Source : | Human fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6524 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 4870 bp Genome contig ID gi51511721r_171593163 PolyA signal sequence
(None) +----*----+----*----+----*----+----
AAAAAAGTGCTTGACTGGTTTCAAGCTTCATCATGFlanking genome sequence
(99947 - 99898) ----+----*----+----*----+----*----+----*----+----*
AAGATGCAGTGTCTATGGATTTTATTTGGCAGGAGAAAGGGTACATAGCT
Chr f/r start end exon identity class ContigView(URL based/DAS) 5 r 171693110 171705850 2 99.0 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 550 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: AGGAGTGGACAGTCTGGTATT | |
: ATGTAAGACTTGGGCACGATG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 5 |
: unigene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |