HUGE |
Gene/Protein Characteristic Table for KIAA1307 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK07275 |
---|---|
Accession No. : | AB037728 |
Description : | Zinc finger UBR1-type protein 1. |
HUGO Gene Name : | ubiquitin protein ligase E3 component n-recognin 4 (UBR4) |
Clone Name : | fh08302 [Vector Info] |
Source : | Human fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5601 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 564 bp Genome contig ID gi89161185r_19250005 PolyA signal sequence
(ATTAAA,-24) +----*----+----*----+----*----+----
ATATATACACGATTAAAGTGCTGCAAATATCTCAGFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AAGATAAAGTTTCTCTATGTCTATAAAATTGACGTGATTTACTTCTTTGC
Chr f/r start end exon identity class ContigView(URL based/DAS) 1 r 19350005 19378151 31 100.0 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1678 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: TGGGACTCAAGCAATAGAACG | |
: AGGGGAAGTCAAACCAGCGTG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 1 |
: GeneBridge 4 | |
: TGGGACTCAAGCAATAGAACG | |
: AGGGGAAGTCAAACCAGCGTG | |
: 98 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |