HUGE

Gene/Protein Characteristic Table for KIAA1311

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06606
Accession No. :	AB037732
Description :	RNA-binding protein 27.
HUGO Gene Name :	RNA binding motif protein 27 (RBM27)
Clone Name :	fh11512 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5774 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3102 bp

Genome contig ID gi51511721f_145489589
PolyA signal sequence
(AATAAA,-34)
+----*----+----*----+----*----+----
CAATAAAGATGCAATATGGAATGGTTCACAATTGG
Flanking genome sequence
(159301 - 159350)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAGAAAAAAGATGAAAGTATTACAAATTTAAAAGAATTTGGA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 5 f 145589589 145648888 17 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 889 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9P2N5	100.0	RNA-binding pro...	Homo sapiens
XP_527062	99.9	RNA binding mot...	Pan troglodytes
XP_001100227	99.5	similar to cuta...	Macaca mulatta
XP_544327	97.1	similar to cuta...	Canis lupus fam...
XP_001503958	97.1	RNA binding mot...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000571 103 129 PF00642 Zinc finger

IPR000504 445 498 PF00076 RNA recognition motif

HMMSmart IPR000504 430 499 SM00360 RNA recognition motif

ProfileScan IPR000504 429 503 PS50102 RNA recognition motif

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000571	103	129	PF00642	Zinc finger
IPR000504	445	498	PF00076	RNA recognition motif
HMMSmart	IPR000504	430	499	SM00360	RNA recognition motif
ProfileScan	IPR000504	429	503	PS50102	RNA recognition motif

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CTTGCTCCTTACTCCTCCATC

Primer_r
: TCCTTTGTTCCCTCTATCACG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 5

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3102 bp
Genome contig ID	gi51511721f_145489589
PolyA signal sequence (AATAAA,-34)	+--------+--------+----*----+---- CAATAAAGATGCAATATGGAATGGTTCACAATTGG
Flanking genome sequence (159301 - 159350)	----+--------+--------+--------+--------+----* AAAAAAAAAAGAAAAAAGATGAAAGTATTACAAATTTAAAAGAATTTGGA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	5	f	145589589	145648888	17	100.0	Perfect prediction

Primer_f	: CTTGCTCCTTACTCCTCCATC
Primer_r	: TCCTTTGTTCCCTCTATCACG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1311

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information