HUGE

Gene/Protein Characteristic Table for KIAA1313

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06288
Accession No. :	AB037734
Description :	Protocadherin-19 precursor.
HUGO Gene Name :	protocadherin 19 (PCDH19)
Clone Name :	fh12154 [Vector Info]
Flexi ORF Clone :	pF1KA1313
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5818 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 4621 bp

Genome contig ID gi89161218r_99333300
PolyA signal sequence
(ATTAAA,-23)
+----*----+----*----+----*----+----
ATGCATTTTAGTATTAAAGGCTATTATGGAAAAAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
TATTGAGTGTTTGGTGGAATGTGTTTCAGAGAGTGTTTGTAGGCTCGCGG

Features of the protein sequence	Description

Length: 398 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
CAI41393	3.1e-161	100.0	protocadherin 1...	Homo sapiens
EAX02805	4.5e-161	100.0	protocadherin 1...	Homo sapiens
BAG10449	4.9e-161	100.0	protocadherin-1...	synthetic construct
NP_065817	5.9e-160	99.7	protocadherin 1...	Homo sapiens
CAH18133	7.7e-160	99.5	hypothetical pr...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB046782	1.3e-07	26.9	KIAA1562
AB037821	4.5e-05	29.6	KIAA1400

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TTTAATGACCAAGAGCCAGAC

Primer_r
: TAGTGTCATCAGGCTCATTCC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: X

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: ATGTCAACAATGGCCCTACTC
Primer_r	: CTTCAGACGCTTCACACCAGG
PCR product length	: 134 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	4621 bp
Genome contig ID	gi89161218r_99333300
PolyA signal sequence (ATTAAA,-23)	+--------+--------+----*----+---- ATGCATTTTAGTATTAAAGGCTATTATGGAAAAAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TATTGAGTGTTTGGTGGAATGTGTTTCAGAGAGTGTTTGTAGGCTCGCGG

Primer_f	: TTTAATGACCAAGAGCCAGAC
Primer_r	: TAGTGTCATCAGGCTCATTCC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1313

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information