HUGE

Gene/Protein Characteristic Table for KIAA1326

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06287
Accession No. :	AB037747
Description :	Protocadherin-11 X-linked precursor.
HUGO Gene Name :
Clone Name :	fh14376 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5563 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 4287 bp

Genome contig ID gi89161218f_90920664
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
CTTATTAATATATATTAATAAAAGTTATGAGAAAT
Flanking genome sequence
(844220 - 844269)
----+----*----+----*----+----*----+----*----+----*
AAACATTCATTGTTATTGTGTGTGTTAATTCAAAACTCAAATGATTCACT

Features of the protein sequence	Description

Length: 424 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9BZA7	3.2e-161	100.0	Protocadherin-1...	Homo sapiens
AAK82655	3.2e-161	100.0	protocadherin-S...	Homo sapiens
Q71M42	1.4e-160	99.5	Protocadherin-1...	Pan troglodytes
Q6WYY1	3.2e-160	99.3	Protocadherin-1...	Pan paniscus
Q6X862	6.1e-159	99.1	Protocadherin-1...	Gorilla gorilla...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR013585 1 78 PF08374 Protocadherin

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013585	1	78	PF08374	Protocadherin

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TAGACAGTGGTATAGGTTGAC

Primer_r
: GATTGTTGGTTCAGTAAGACG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 14

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TAGACAGTGGTATAGGTTGAC
Primer_r	: GATTGTTGGTTCAGTAAGACG
PCR product length	: 98 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	4287 bp
Genome contig ID	gi89161218f_90920664
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- CTTATTAATATATATTAATAAAAGTTATGAGAAAT
Flanking genome sequence (844220 - 844269)	----+--------+--------+--------+--------+----* AAACATTCATTGTTATTGTGTGTGTTAATTCAAAACTCAAATGATTCACT

Gene/Protein Characteristic Table for KIAA1326

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information