HUGE

Gene/Protein Characteristic Table for KIAA1348

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00810
Accession No. :	AB037769
Description :	[Pyruvate dehydrogenase [lipoamide]]-phosphatase 2, mitochondrial precursor.
HUGO Gene Name :
Clone Name :	fj00937 [Vector Info]
Flexi ORF Clone :	pF1KSDA1348
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 3830 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2078 bp

Genome contig ID gi51511732f_65371937
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CTCCAGCCTGGGCAACAAGAGTGAAACTCTGTCTC
Flanking genome sequence
(107421 - 107470)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAATCCATCTTATCTCTTAGTCCGTCCTTCCTTCC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 16 f 65471937 65479356 2 99.0 Perfect prediction

Features of the protein sequence	Description

Length: 545 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9P2J9	0	100.0	[Pyruvate dehyd...	Homo sapiens
XP_001159664	0	99.8	pyruvate dehydr...	Pan troglodytes
CAH91302	0	98.9	hypothetical pr...	Pongo abelii
XP_001085713	0	98.9	pyruvate dehydr...	Macaca mulatta
XP_001496201	5.2e-207	89.2	similar to pyru...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB032983	0.00032	24.4	KIAA1157

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR014045 121 503 PF00481 Protein phosphatase 2C

HMMSmart IPR001932 109 531 SM00332 Protein phosphatase 2C-related

ScanRegExp IPR000222 152 160 PS01032 Protein phosphatase 2C

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR014045	121	503	PF00481	Protein phosphatase 2C
HMMSmart	IPR001932	109	531	SM00332	Protein phosphatase 2C-related
ScanRegExp	IPR000222	152	160	PS01032	Protein phosphatase 2C

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ACCACCATTGCTAGTCCTCAG

Primer_r
: CAAAGAGTCTACAGCCCACAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 16

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: ACCACCATTGCTAGTCCTCAG
Primer_r	: CAAAGAGTCTACAGCCCACAG
PCR product length	: 104 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2078 bp
Genome contig ID	gi51511732f_65371937
PolyA signal sequence (None)	+--------+--------+----*----+---- CTCCAGCCTGGGCAACAAGAGTGAAACTCTGTCTC
Flanking genome sequence (107421 - 107470)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAATCCATCTTATCTCTTAGTCCGTCCTTCCTTCC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	16	f	65471937	65479356	2	99.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA1348

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information