HUGE

Gene/Protein Characteristic Table for KIAA1367

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04619
Accession No. :	AB037788
Description :	Cleavage and polyadenylation specificity factor subunit 2.
HUGO Gene Name :	cleavage and polyadenylation specific factor 2, 100kDa (CPSF2)
Clone Name :	fj03001 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 4196 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Features of the protein sequence	Description

Length: 579 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG51207	100.0	unnamed protein...	Homo sapiens
Q9P2I0	100.0	Cleavage and po...	Homo sapiens
BAE00542	99.8	unnamed protein...	Macaca fascicularis
XP_001092942	99.8	similar to clea...	Macaca mulatta
Q10568	99.5	Cleavage and po...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR011108 324 366 PF07521 RNA-metabolising metallo-beta-lactamase

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR011108	324	366	PF07521	RNA-metabolising metallo-beta-lactamase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ACTCACTTGTCAGCTCTCTTC

Primer_r
: TATAACGCTAGAATCTGAGGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 14

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Primer_f	: ACTCACTTGTCAGCTCTCTTC
Primer_r	: TATAACGCTAGAATCTGAGGG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1367

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information