HUGE

Gene/Protein Characteristic Table for KIAA1393

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07215
Accession No. :	AB037814
Description :	tRNA.
HUGO Gene Name :
Clone Name :	hj06562 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5164 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 3659 bp

Genome contig ID gi51511730r_60407922
PolyA signal sequence
(AATAAA,-25)
+----*----+----*----+----*----+----
AAGTATCTTTAATAAAGCTGGATACAGTTTGAAAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAGTGTGGCAATTTGTTTTAGCTTGTTCTGTAAGTACCTACA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 14 r 60507922 60516343 4 99.0 Perfect prediction

Features of the protein sequence	Description

Length: 500 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAI08285	1.4e-206	99.8	TRM5 tRNA methy...	Homo sapiens
Q32P41	7.1e-206	99.6	tRNA (guanine-N...	Homo sapiens
XP_522871	2.9e-205	99.2	tRNA-(N1G37) me...	Pan troglodytes
XP_001097647	4.7e-196	93.8	similar to tRNA...	Macaca mulatta
XP_001097447	4.9e-196	93.8	similar to tRNA...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR003402 189 410 PF02475 Protein of unknown function Met10

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003402	189	410	PF02475	Protein of unknown function Met10

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GACATCTGTTGGGACCTGACC

Primer_r
: GCTCTTTTGACAGGTGCCATC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 14

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TAGCTTGGACATCCCTGACAC
Primer_r	: GTGTTTCTGTTTCTGGCATGG
PCR product length	: 99 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	3659 bp
Genome contig ID	gi51511730r_60407922
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- AAGTATCTTTAATAAAGCTGGATACAGTTTGAAAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAAGTGTGGCAATTTGTTTTAGCTTGTTCTGTAAGTACCTACA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	14	r	60507922	60516343	4	99.0	Perfect prediction

Primer_f	: GACATCTGTTGGGACCTGACC
Primer_r	: GCTCTTTTGACAGGTGCCATC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1393

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information