HUGE

Gene/Protein Characteristic Table for KIAA1397

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00825
Accession No. :	AB037818
Description :	Tubby-related protein 4.
HUGO Gene Name :	tubby like protein 4 (TULP4)
Clone Name :	hj08255 [Vector Info]
Flexi ORF Clone :	pF1KSDA1397
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4810 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1416 bp

Genome contig ID gi89161210f_158553680
PolyA signal sequence
(ATTAAA,-22)
+----*----+----*----+----*----+----
CTGAGAAAACGTTATTAAAATTGTAATACCTAGGT
Flanking genome sequence
(295358 - 295407)
----+----*----+----*----+----*----+----*----+----*
AGTTGGTTGATCACAGTTTGTTAATTGTATAAAAAAAAATTACCTAGAAT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 6 f 158653680 158849036 13 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 686 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAG01020	100.0	tubby super-fam...	Homo sapiens
XP_001145255	99.9	tubby like prot...	Pan troglodytes
XP_001145331	100.0	tubby like prot...	Pan troglodytes
Q9NRJ4	100.0	Tubby-related p...	Homo sapiens
AAF87975	100.0	tubby super-fam...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037757	9e-16	29.3	KIAA1336

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001680 80 118 PF00400 WD40 repeat

IPR001496 382 419 PF07525 SOCS protein

HMMSmart IPR001680 79 118 SM00320 WD40 repeat

IPR001680 167 203 SM00320 WD40 repeat

ProfileScan IPR001680 86 117 PS50082 WD40 repeat

IPR001680 86 212 PS50294 WD40 repeat

IPR001496 381 422 PS50225 SOCS protein

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001680	80	118	PF00400	WD40 repeat
IPR001496	382	419	PF07525	SOCS protein
HMMSmart	IPR001680	79	118	SM00320	WD40 repeat
IPR001680	167	203	SM00320	WD40 repeat
ProfileScan	IPR001680	86	117	PS50082	WD40 repeat
IPR001680	86	212	PS50294	WD40 repeat
IPR001496	381	422	PS50225	SOCS protein

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CCACTAGTTTCATCGTTTGTC

Primer_r
: GAGAAAACTGCTACCACTACC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 6

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CCACTAGTTTCATCGTTTGTC
Primer_r	: GAGAAAACTGCTACCACTACC
PCR product length	: 128 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1416 bp
Genome contig ID	gi89161210f_158553680
PolyA signal sequence (ATTAAA,-22)	+--------+--------+----*----+---- CTGAGAAAACGTTATTAAAATTGTAATACCTAGGT
Flanking genome sequence (295358 - 295407)	----+--------+--------+--------+--------+----* AGTTGGTTGATCACAGTTTGTTAATTGTATAAAAAAAAATTACCTAGAAT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	6	f	158653680	158849036	13	99.4	Perfect prediction

Gene/Protein Characteristic Table for KIAA1397

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information