HUGE

Gene/Protein Characteristic Table for KIAA1411

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :
Accession No. :	AB037832
Description :
HUGO Gene Name :
Clone Name :	fh10052 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5901 bp
Physical map
Restriction map
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
Comparison between the cloned and the revised DNA sequences.
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq. revised DNA seq.
Warning for N-terminal truncation:
NO NO

Warning for coding interruption:
YES NO

Integrity of 3' end

Length of 3'UTR 1251 bp

Genome contig ID gi89161210f_71092895
PolyA signal sequence
(AATGAA,-33)
+----*----+----*----+----*----+----
TAAATGAACAAATGGCTATCTGGAGGAACAGCTAC
Flanking genome sequence
(234703 - 234752)
----+----*----+----*----+----*----+----*----+----*
AACCCTTGTAATCCTTTGCTTATTCTCTGAATACTAGAGGTATATATATT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 6 f 71192895 71327596 20 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 1522 aa
This protein sequence is predicted from the revised DNA sequence

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_853259	91.1	similar to CG32...	Canis lupus fam...
XP_532195	90.8	similar to CG32...	Canis lupus fam...
CAB66754	99.9	hypothetical pr...	Homo sapiens
Q6NS59	83.9	Protein FAM135A.	Mus musculus
AAH70446	83.9	RIKEN cDNA 4921...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR007751 1251 1447 PF05057 Protein of unknown function DUF676

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007751	1251	1447	PF05057	Protein of unknown function DUF676

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GCTATGTTCCTTATCACTCTG

Primer_r
: TTGATGACATTATAGCGAACC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 6

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.	revised DNA seq.
Warning for N-terminal truncation:	NO	NO
Warning for coding interruption:	YES	NO

Length of 3'UTR	1251 bp
Genome contig ID	gi89161210f_71092895
PolyA signal sequence (AATGAA,-33)	+--------+--------+----*----+---- TAAATGAACAAATGGCTATCTGGAGGAACAGCTAC
Flanking genome sequence (234703 - 234752)	----+--------+--------+--------+--------+----* AACCCTTGTAATCCTTTGCTTATTCTCTGAATACTAGAGGTATATATATT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	6	f	71192895	71327596	20	100.0	Perfect prediction

Primer_f	: GCTATGTTCCTTATCACTCTG
Primer_r	: TTGATGACATTATAGCGAACC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1411

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information