HUGE

Gene/Protein Characteristic Table for KIAA1432

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05660
Accession No. :	AB037853
Description :
HUGO Gene Name :
Clone Name :	fj02309 [Vector Info]
Source :	Human fetal brain
Note :	We replaced fj00670, former representative clones for KIAA1432 with fj02309. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 4961 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2570 bp

Genome contig ID gi89161216f_5647341
PolyA signal sequence
(AATAAA,-16)
+----*----+----*----+----*----+----
TCTCCCCTTGGTAAAGGGCAATAAAACCATTACAC
Flanking genome sequence
(119215 - 119264)
----+----*----+----*----+----*----+----*----+----*
AAACTTTGGTTTATTCATCATCTCAGGTTAACAGCCACGAAAATCATCTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 9 f 5747341 5766554 11 99.5 Internal No-hit

Features of the protein sequence	Description

Length: 796 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI44297	100.0	Unknown (protei...	Homo sapiens
Q4ADV7	100.0	Protein RIC1 ho...	Homo sapiens
XP_520477	99.6	hypothetical pr...	Pan troglodytes
XP_001108907	98.7	similar to CG90...	Macaca mulatta
XP_001492194	96.6	similar to Prot...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR009771 104 377 PF07064 Protein of unknown function DUF1339

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR009771	104	377	PF07064	Protein of unknown function DUF1339

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TGCTACCCTTCTATTCAACAC

Primer_r
: ACTGGGATAAACTGATGCTTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 9

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2570 bp
Genome contig ID	gi89161216f_5647341
PolyA signal sequence (AATAAA,-16)	+--------+--------+----*----+---- TCTCCCCTTGGTAAAGGGCAATAAAACCATTACAC
Flanking genome sequence (119215 - 119264)	----+--------+--------+--------+--------+----* AAACTTTGGTTTATTCATCATCTCAGGTTAACAGCCACGAAAATCATCTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	9	f	5747341	5766554	11	99.5	Internal No-hit

Primer_f	: TGCTACCCTTCTATTCAACAC
Primer_r	: ACTGGGATAAACTGATGCTTC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1432

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information