HUGE |
Gene/Protein Characteristic Table for KIAA1446 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK04262 |
---|---|
Accession No. : | AB040879 |
Description : | Brain-enriched guanylate kinase-associated protein. |
HUGO Gene Name : | brain-enriched guanylate kinase-associated homolog (rat) (BEGAIN) |
Clone Name : | fg06734 [Vector Info] |
Source : | Human fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5806 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 816 bp Genome contig ID gi51511730r_99973243 PolyA signal sequence
(AATAAA,-18) +----*----+----*----+----*----+----
TGTATTTTGCATTCATTAATAAAAGACACCGGTGGFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AAAGAATCTGGGTTGGGCTGTTTCTCCTCCTCCTGCCTTTTGGTCTCGGG
Chr f/r start end exon identity class ContigView(URL based/DAS) 14 r 100073243 100085979 5 99.0 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 645 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: GGATTCAGAGCAACTACATGG | |
: TTGCAGTCCTTCCTATAGAGC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 14 |
: GeneBridge 4 | |
: TTTCTTAACGCACTTGGCCTC | |
: CCTCTTCGTGGACACAACTTC | |
: 211 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |