HUGE

Gene/Protein Characteristic Table for KIAA1453

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00841
Accession No. :	AB040886
Description :	Ubiquitin carboxyl-terminal hydrolase 36.
HUGO Gene Name :	ubiquitin specific peptidase 36 (USP36)
Clone Name :	fh14729 [Vector Info]
Flexi ORF Clone :	pF1KSDA1453
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5879 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 2295 bp

Genome contig ID gi51511734r_74195144
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TACATTGATTTTGATTACAAATGGTTCTGTATTAT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATACCACCGTTCTGACTGCTTTTTTCACTTATAGCTTGGAAATTGTCTTC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 17 r 74295144 74348457 21 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 1123 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG10071	100.0	ubiquitin carbo...	synthetic construct
Q9P275	99.8	Ubiquitin carbo...	Homo sapiens
EAW89534	99.6	ubiquitin speci...	Homo sapiens
AAH71582	99.6	USP36 protein [...	Homo sapiens
XP_001108648	92.3	similar to ubiq...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB028986	0.00014	29.4	KIAA1063

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001394 121 422 PF00443 Peptidase C19

ProfileScan IPR001394 124 426 PS50235 Peptidase C19

ScanRegExp IPR001394 125 140 PS00972 Peptidase C19

IPR001394 367 385 PS00973 Peptidase C19

IPR003006 378 384 PS00290 Immunoglobulin/major histocompatibility complex motif

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001394	121	422	PF00443	Peptidase C19
ProfileScan	IPR001394	124	426	PS50235	Peptidase C19
ScanRegExp	IPR001394	125	140	PS00972	Peptidase C19
IPR001394	367	385	PS00973	Peptidase C19
IPR003006	378	384	PS00290	Immunoglobulin/major histocompatibility complex motif

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TCTGGCTGCTCTTCATTGACC

Primer_r
: TACATGCTACTCGTTTACAGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 17

Experimental conditions

Panel name	: CCR
Primer_f	: TCTGGCTGCTCTTCATTGACC
Primer_r	: TACATGCTACTCGTTTACAGG
PCR product length	: 104 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	2295 bp
Genome contig ID	gi51511734r_74195144
PolyA signal sequence (None)	+--------+--------+----*----+---- TACATTGATTTTGATTACAAATGGTTCTGTATTAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATACCACCGTTCTGACTGCTTTTTTCACTTATAGCTTGGAAATTGTCTTC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	17	r	74295144	74348457	21	99.4	Perfect prediction

Gene/Protein Characteristic Table for KIAA1453

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information