HUGE

Gene/Protein Characteristic Table for KIAA1458

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00843
Accession No. :	AB040891
Description :	SLAIN motif family, member 2.
HUGO Gene Name :
Clone Name :	fh16694 [Vector Info]
Flexi ORF Clone :	pF1KSDA1458
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5843 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3983 bp

Genome contig ID gi89161207f_47938400
PolyA signal sequence
(ATTAAA,-26)
+----*----+----*----+----*----+----
ACTAAAAATATTAAAAAGTATAAAGGTAAAAAATG
Flanking genome sequence
(184435 - 184484)
----+----*----+----*----+----*----+----*----+----*
ATAGTTGTCTGCAATCCCATAATCCGGAAATATTGAAGTACTGTCCGTAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 4 f 48038400 48122833 8 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 612 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001100721	3.6e-181	98.4	hypothetical pr...	Macaca mulatta
Q9P270	2.2e-175	100.0	SLAIN motif-con...	Homo sapiens
BAF83695	6.5e-175	99.7	unnamed protein...	Homo sapiens
Q3MHV6	4.1e-170	96.9	SLAIN motif-con...	Bos taurus
BAE27166	4.4e-167	92.4	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TCAGGCTATCCAAAACTTCAC

Primer_r
: TCAATCTGTAGTTTCCTGGTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 4

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TCAGGCTATCCAAAACTTCAC
Primer_r	: TCAATCTGTAGTTTCCTGGTG
PCR product length	: 136 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	3983 bp
Genome contig ID	gi89161207f_47938400
PolyA signal sequence (ATTAAA,-26)	+--------+--------+----*----+---- ACTAAAAATATTAAAAAGTATAAAGGTAAAAAATG
Flanking genome sequence (184435 - 184484)	----+--------+--------+--------+--------+----* ATAGTTGTCTGCAATCCCATAATCCGGAAATATTGAAGTACTGTCCGTAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	4	f	48038400	48122833	8	99.3	Perfect prediction

Gene/Protein Characteristic Table for KIAA1458

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information