HUGE

Gene/Protein Characteristic Table for KIAA1461

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05942
Accession No. :	AB040894
Description :	Methyl-CpG-binding domain protein 5.
HUGO Gene Name :	methyl-CpG binding domain protein 5 (MBD5)
Clone Name :	fh17578 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5285 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 510 bp

Genome contig ID gi89161199f_148832508
PolyA signal sequence
(AATAAA,-16)
+----*----+----*----+----*----+----
CTACCAGTGTAAAGTGATAAATAAAAATACAACCT
Flanking genome sequence
(154984 - 155033)
----+----*----+----*----+----*----+----*----+----*
AAATGCTTTTCTATGATAATGTAAAAGATGCTGTTTTTGTATTTAACAGC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 2 f 148932508 148987490 10 99.7 Perfect prediction

Features of the protein sequence	Description

Length: 1498 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9P267	100.0	Methyl-CpG-bind...	Homo sapiens
EAX11552	99.9	methyl-CpG bind...	Homo sapiens
XP_541030	97.1	similar to meth...	Canis lupus fam...
XP_001488025	96.9	methyl-CpG bind...	Equus caballus
XP_001787441	96.1	similar to meth...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB067474	1.7e-07	28.1	KIAA1887

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001739 25 88 PF01429 Methyl-CpG binding

IPR000313 1386 1449 PF00855 PWWP

HMMSmart IPR001739 15 92 SM00391 Methyl-CpG binding

ProfileScan IPR001739 15 85 PS50982 Methyl-CpG binding

IPR000313 1389 1413 PS50812 PWWP

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001739	25	88	PF01429	Methyl-CpG binding
IPR000313	1386	1449	PF00855	PWWP
HMMSmart	IPR001739	15	92	SM00391	Methyl-CpG binding
ProfileScan	IPR001739	15	85	PS50982	Methyl-CpG binding
IPR000313	1389	1413	PS50812	PWWP

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GCCAATCAAAGTCTCTGTGTG

Primer_r
: AGTGTGCATTAGGTACGCTTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 2

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GCCAATCAAAGTCTCTGTGTG
Primer_r	: AGTGTGCATTAGGTACGCTTG
PCR product length	: 215 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	510 bp
Genome contig ID	gi89161199f_148832508
PolyA signal sequence (AATAAA,-16)	+--------+--------+----*----+---- CTACCAGTGTAAAGTGATAAATAAAAATACAACCT
Flanking genome sequence (154984 - 155033)	----+--------+--------+--------+--------+----* AAATGCTTTTCTATGATAATGTAAAAGATGCTGTTTTTGTATTTAACAGC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	2	f	148932508	148987490	10	99.7	Perfect prediction

Gene/Protein Characteristic Table for KIAA1461

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information