HUGE |
Gene/Protein Characteristic Table for KIAA1462 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Mapping | |
Product ID : | ORK01170 |
---|---|
Accession No. : | AB040895 |
Description : | |
HUGO Gene Name : | |
Clone Name : | ef00562 [Vector Info] |
Flexi ORF Clone : | pF1KA1462
![]() |
Source : | |
Note : | We replaced fh18445, former representative clones for KIAA1462 with ef00562. (2001/2/22) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 7539 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 3429 bp Genome contig ID gi89161187r_30243390 PolyA signal sequence
(ATTAAA,-33) +----*----+----*----+----*----+----
CAATTAAATGTCAGGATAGCATCTCTTGCAAAGTGFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
ACCAGTGCAGCAGAATTGTCTTTCTATCCATATTTGAGCTTAGAGAAACA
Chr f/r start end exon identity class ContigView(URL based/DAS) 10 r 30343390 30376777 3 99.0 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1363 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Motif_DB | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
None | - | - | - | - | - |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
RH mapping information |
Description | |
---|---|---|
: 10 |
: unigene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |