HUGE |
Gene/Protein Characteristic Table for KIAA1468 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK05664 |
---|---|
Accession No. : | AB040901 |
Description : | |
HUGO Gene Name : | |
Clone Name : | fj01719 [Vector Info] |
Flexi ORF Clone : | pF1KA1468
![]() |
Source : | Human fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4661 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1578 bp Genome contig ID gi51511735f_57939646 PolyA signal sequence
(AATAAA,-18) +----*----+----*----+----*----+----
AATGTTGATCTATTATAAATAAAATGTTTTTGCATFlanking genome sequence
(185681 - 185730) ----+----*----+----*----+----*----+----*----+----*
ATGTTTTTGATTTGGTTTGGGCTATGCATTTTACTTTCGTTTTGAAACAC
Chr f/r start end exon identity class ContigView(URL based/DAS) 18 f 58039644 58125325 26 99.6 Terminal No-hit
Features of the protein sequence |
Description | |
---|---|---|
Length: 985 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: CCTCGTCCCTTAAAGTCAGTG | |
: CATTAACCCCTCAAACCAAGC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 18 |
: unigene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |