HUGE

Gene/Protein Characteristic Table for KIAA1492

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Mapping

Product ID :	ORK00240
Accession No. :	AB040925
Description :	Inactive dipeptidyl peptidase 10.
HUGO Gene Name :
Clone Name :	bj00389 [Vector Info]
Flexi ORF Clone :	pF1KA1492
Source :	Human adult brain
Note :	We replaced fj08453, former representative clones for KIAA1492 with bj00389. (2001/2/22)

Features of the cloned DNA sequence	Description

Length: 4394 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2015 bp

Genome contig ID gi89161199f_115536272
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
GAGTATCATTTAAAAAGTATTTGCCTTTTACTGTC
Flanking genome sequence
(782136 - 782185)
----+----*----+----*----+----*----+----*----+----*
ATCATTTCTCTTGTTTTATTATTATTATCAATGTTTATCTATTTTTCAAT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 2 f 115783283 116318406 23 99.4 Both No-hit

Features of the protein sequence	Description

Length: 792 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_515752	99.6	dipeptidyl pept...	Pan troglodytes
EAW95187	100.0	dipeptidyl-pept...	Homo sapiens
AAQ91190	99.9	dipeptidyl pept...	Homo sapiens
XP_001104553	99.2	similar to dipe...	Macaca mulatta
ABI16087	99.9	DPPY splice var...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR002469 129 496 PF00930 Peptidase S9B

IPR001375 576 780 PF00326 Peptidase S9

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002469	129	496	PF00930	Peptidase S9B
IPR001375	576	780	PF00326	Peptidase S9

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 32 AIALLVILVVCSLITMSVILLTP 54 PRIMARY 23

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	32	AIALLVILVVCSLITMSVILLTP	54	PRIMARY	23

RH mapping information	Description

Chromosome No.

: 2

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2015 bp
Genome contig ID	gi89161199f_115536272
PolyA signal sequence (None)	+--------+--------+----*----+---- GAGTATCATTTAAAAAGTATTTGCCTTTTACTGTC
Flanking genome sequence (782136 - 782185)	----+--------+--------+--------+--------+----* ATCATTTCTCTTGTTTTATTATTATTATCAATGTTTATCTATTTTTCAAT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	2	f	115783283	116318406	23	99.4	Both No-hit

Gene/Protein Characteristic Table for KIAA1492

Features of the cloned DNA sequence

Features of the protein sequence

RH mapping information