HUGE |
Gene/Protein Characteristic Table for KIAA1493 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK04710 |
---|---|
Accession No. : | AB040926 |
Description : | doublecortin domain containing 5. |
HUGO Gene Name : | |
Clone Name : | fj08657 [Vector Info] |
Source : | Human fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4768 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 3445 bp Genome contig ID gi51511727r_30741730 PolyA signal sequence
(AATAAA,-21) +----*----+----*----+----*----+----
TTTTATTCAAAAACAATAAACCATGTAGATTTATTFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AGCATGTGTGGGTGTGATTTTTGCATCTAGGAATCTTAAGTGGGAAAAGA
Chr f/r start end exon identity class ContigView(URL based/DAS) 11 r 30841730 30884840 11 99.2 Terminal No-hit
Features of the protein sequence |
Description | |
---|---|---|
Length: 415 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: CATCACTCTTCTTGTCTTGGC | |
: CACATCAGCCCTCCAAATCAC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 11 |
: unigene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |