HUGE

Gene/Protein Characteristic Table for KIAA1504

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00854
Accession No. :	AB040937
Description :	exonuclease domain containing 1.
HUGO Gene Name :	exoribonuclease 2 (ERI2)
Clone Name :	hk04058 [Vector Info]
Flexi ORF Clone :	pF1KSDA1504
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 3846 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1380 bp

Genome contig ID gi51511732r_20615167
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
CTTTACTACCTAAAATAAATATTTGAAACACCAGG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAATGAGTTATGCATTTGTATGTTTTAGTATGTCTTGTTTGCTTGCTCT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 16 r 20715167 20719012 1 99.0 Perfect prediction

Features of the protein sequence	Description

Length: 447 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAF85283	1.7e-177	99.8	unnamed protein...	Homo sapiens
A8K979	1.9e-177	99.8	Exonuclease dom...	Homo sapiens
BAG10082	1.1e-170	100.0	exonuclease dom...	synthetic construct
AAC31669	1.1e-169	99.8	Unknown gene pr...	Homo sapiens
XP_001149333	2e-134	99.1	hypothetical pr...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR010666 351 399 PF06839 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR010666	351	399	PF06839	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ATGTCATCAGTTCAGTTTGGG

Primer_r
: ACAGCACCTTACAAATATCCC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 16

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: ATGTCATCAGTTCAGTTTGGG
Primer_r	: ACAGCACCTTACAAATATCCC
PCR product length	: 155 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1380 bp
Genome contig ID	gi51511732r_20615167
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- CTTTACTACCTAAAATAAATATTTGAAACACCAGG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAATGAGTTATGCATTTGTATGTTTTAGTATGTCTTGTTTGCTTGCTCT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	16	r	20715167	20719012	1	99.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA1504

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information