HUGE

Gene/Protein Characteristic Table for KIAA1506

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06006
Accession No. :	AB040939
Description :	Myeloid/lymphoid or mixed-lineage leukemia protein 3 homolog.
HUGO Gene Name :	myeloid/lymphoid or mixed-lineage leukemia 3 (MLL3)
Clone Name :	ff04330 [Vector Info]
Source :	Human fetal brain
Note :	We replaced hk04442, former representative clones for KIAA1506 with ff04330. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 9929 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 0 bp

Genome contig ID gi89161213r_151386957
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
ACTCAGAGGACGGGTGAGAAAGCAGCACCTCGCTC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAGAAAAGGAAAAAGGACGAAGAGGAGAAACAAGCTATGTACTCTAGCA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 7 r 151486957 151578940 33 99.8 Perfect prediction

Features of the protein sequence	Description

Length: 3309 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI51838	100.0	MLL3 protein [H...	Homo sapiens
Q8NEZ4	100.0	Histone-lysine ...	Homo sapiens
EAW53972	100.0	hCG1990594, iso...	Homo sapiens
EAW53971	100.0	hCG1990594, iso...	Homo sapiens
AAK00583	99.8	MLL3 [Homo sapi...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001965 404 455 PF00628 Zinc finger

IPR001965 456 502 PF00628 Zinc finger

IPR001965 531 584 PF00628 Zinc finger

IPR000910 1100 1153 PF00505 HMG1/2 (high mobility group) box

HMMSmart IPR001965 404 453 SM00249 Zinc finger

IPR001965 454 500 SM00249 Zinc finger

IPR001965 531 582 SM00249 Zinc finger

IPR000910 1094 1158 SM00398 HMG1/2 (high mobility group) box

ProfileScan IPR001965 402 455 PS50016 Zinc finger

IPR001965 452 502 PS50016 Zinc finger

IPR001965 529 584 PS50016 Zinc finger

ScanRegExp IPR001965 405 473 PS01359 Zinc finger

IPR000194 851 860 PS00152 ATPase

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001965	404	455	PF00628	Zinc finger
IPR001965	456	502	PF00628	Zinc finger
IPR001965	531	584	PF00628	Zinc finger
IPR000910	1100	1153	PF00505	HMG1/2 (high mobility group) box
HMMSmart	IPR001965	404	453	SM00249	Zinc finger
IPR001965	454	500	SM00249	Zinc finger
IPR001965	531	582	SM00249	Zinc finger
IPR000910	1094	1158	SM00398	HMG1/2 (high mobility group) box
ProfileScan	IPR001965	402	455	PS50016	Zinc finger
IPR001965	452	502	PS50016	Zinc finger
IPR001965	529	584	PS50016	Zinc finger
ScanRegExp	IPR001965	405	473	PS01359	Zinc finger
IPR000194	851	860	PS00152	ATPase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GCCCTCCTTCATTTGTTCCTG

Primer_r
: CTGGAGGTGCTGCTGGTAAAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 7

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	0 bp
Genome contig ID	gi89161213r_151386957
PolyA signal sequence (None)	+--------+--------+----*----+---- ACTCAGAGGACGGGTGAGAAAGCAGCACCTCGCTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAGAAAAGGAAAAAGGACGAAGAGGAGAAACAAGCTATGTACTCTAGCA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	7	r	151486957	151578940	33	99.8	Perfect prediction

Primer_f	: GCCCTCCTTCATTTGTTCCTG
Primer_r	: CTGGAGGTGCTGCTGGTAAAG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1506

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information