HUGE |
Gene/Protein Characteristic Table for KIAA1525 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Mapping | |
Product ID : | ORK01173 |
---|---|
Accession No. : | AB040958 |
Description : | BTB/POZ domain-containing protein 7. |
HUGO Gene Name : | |
Clone Name : | fj15588 [Vector Info] |
Flexi ORF Clone : | pF1KA1525 |
Source : | Human fetal brain |
Note : | We replaced fj01939, former representative clones for KIAA1525 with fj15588. (2001/2/22) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4818 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1111 bp Genome contig ID gi51511730r_92677550 PolyA signal sequence
(None) +----*----+----*----+----*----+----
GTGCTCCCACCTGGGCAACAGTGAGACCCTGTCTCFlanking genome sequence
(99713 - 99664) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAGGCAGTGGAAATAGAGAAGTAACTTAAAGGTCACA
Chr f/r start end exon identity class ContigView(URL based/DAS) 14 r 92777263 92869120 11 99.6 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1135 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
RH mapping information |
Description | |
---|---|---|
: 14 |
: unigene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |