HUGE |
Gene/Protein Characteristic Table for KIAA1526 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | |
---|---|
Accession No. : | AB040959 |
Description : | Whirlin. |
HUGO Gene Name : | |
Clone Name : | fj04743 [Vector Info] |
Source : | Human fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4762 bp
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
cloned DNA seq. | Warning for N-terminal truncation: YES | YES | Warning for coding interruption: YES | NO | |
Length of 3'UTR 673 bp Genome contig ID gi89161216r_116104182 PolyA signal sequence
(AATAAA,-23) +----*----+----*----+----*----+----
CTTTAATTTTTCAATAAAGAAATCTGAACAAGGTTFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AGACGTCAGCGTGCTGTGTGGTTTACCTGGGTGGCTGGGGTTTCCATGTG
Chr f/r start end exon identity class ContigView(URL based/DAS) 9 r 116204182 116307071 12 99.6 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 963 aa
This protein sequence is predicted from the revised DNA sequence
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: ACAGAAGGTCAGGTCAGGAAC | |
: TTGGACAAAGGCTCAGGCATC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 9 |
: GeneBridge 4 | |
: ACAGAAGGTCAGGTCAGGAAC | |
: TTGGACAAAGGCTCAGGCATC | |
: 190 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |