HUGE

Gene/Protein Characteristic Table for KIAA1527

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04087
Accession No. :	AB040960
Description :	Alpha-protein kinase 1.
HUGO Gene Name :	alpha-kinase 1 (ALPK1)
Clone Name :	fj06850s1 [Vector Info]
Source :	Human fetal brain
Note :	We replaced fj06850, former representative clones for KIAA1527 with fj06850s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 2794 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 387 bp

Genome contig ID gi89161207f_113471481
PolyA signal sequence
(ATTAAA,-20)
+----*----+----*----+----*----+----
GGGAGTTCTTTACATATTAAAAAAATGTGAGCCTT
Flanking genome sequence
(110723 - 110772)
----+----*----+----*----+----*----+----*----+----*
TGTGATACGAATTCAATTTGTTTTCCTGTCTTTTGACATTTGACTTTGCA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 4 f 113571481 113582202 6 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 801 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAK94675	100.0	lymphocyte alph...	Homo sapiens
EAX06275	100.0	alpha-kinase 1,...	Homo sapiens
Q96QP1	99.9	Alpha-protein k...	Homo sapiens
BAG65473	99.8	unnamed protein...	Homo sapiens
NP_079420	99.5	alpha-kinase 1 ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR004166 578 786 PF02816 MHCK/EF2 kinase

HMMSmart IPR004166 579 786 SM00811 MHCK/EF2 kinase

ProfileScan IPR004166 574 794 PS51158 MHCK/EF2 kinase

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004166	578	786	PF02816	MHCK/EF2 kinase
HMMSmart	IPR004166	579	786	SM00811	MHCK/EF2 kinase
ProfileScan	IPR004166	574	794	PS51158	MHCK/EF2 kinase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ATGTGGAGACTGAGACTGAGC

Primer_r
: TCTTTTCTGGCTGACCTGTCG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 4

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	387 bp
Genome contig ID	gi89161207f_113471481
PolyA signal sequence (ATTAAA,-20)	+--------+--------+----*----+---- GGGAGTTCTTTACATATTAAAAAAATGTGAGCCTT
Flanking genome sequence (110723 - 110772)	----+--------+--------+--------+--------+----* TGTGATACGAATTCAATTTGTTTTCCTGTCTTTTGACATTTGACTTTGCA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	4	f	113571481	113582202	6	99.2	Perfect prediction

Primer_f	: ATGTGGAGACTGAGACTGAGC
Primer_r	: TCTTTTCTGGCTGACCTGTCG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1527

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information