HUGE

Gene/Protein Characteristic Table for KIAA1538

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00858
Accession No. :	AB040971
Description :	Zinc finger and BTB domain-containing protein 4.
HUGO Gene Name :	zinc finger and BTB domain containing 4 (ZBTB4)
Clone Name :	fg06773 [Vector Info]
Flexi ORF Clone :	pF1KSDA1538
Source :	Human fetal brain
Note :	We replaced hk07166, former representative clones for KIAA1538 with fg06773. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 5851 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2559 bp

Genome contig ID gi51511734r_7203423
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
CAACTCTGTAGGCCAATAAACCAACAAGACAAATG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AACTGTGCTCCACAGTGGGATGCCAGGTGCAATTATTTGCGTGGCTGGTG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 17 r 7303423 7323668 4 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 1029 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_511299	0	99.3	zinc finger and...	Pan troglodytes
Q9P1Z0	0	100.0	Zinc finger and...	Homo sapiens
AAH43352	0	99.8	Zinc finger and...	Homo sapiens
XP_546592	0	89.9	similar to Zinc...	Canis lupus fam...
BAG53746	2.4e-202	100.0	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR013069 36 194 PF00651 BTB/POZ

IPR007087 250 272 PF00096 Zinc finger

IPR007087 325 347 PF00096 Zinc finger

IPR007087 381 404 PF00096 Zinc finger

IPR007087 742 764 PF00096 Zinc finger

IPR007087 781 803 PF00096 Zinc finger

HMMSmart IPR000210 46 203 SM00225 BTB/POZ-like

IPR015880 250 270 SM00355 Zinc finger

IPR015880 325 347 SM00355 Zinc finger

IPR015880 353 375 SM00355 Zinc finger

IPR015880 381 404 SM00355 Zinc finger

IPR015880 742 764 SM00355 Zinc finger

IPR015880 781 803 SM00355 Zinc finger

ProfileScan IPR000210 46 168 PS50097 BTB/POZ-like

IPR007087 250 278 PS50157 Zinc finger

IPR007087 325 352 PS50157 Zinc finger

IPR007087 353 380 PS50157 Zinc finger

IPR007087 381 404 PS50157 Zinc finger

IPR007087 742 769 PS50157 Zinc finger

IPR007087 781 808 PS50157 Zinc finger

ScanRegExp IPR007087 327 347 PS00028 Zinc finger

IPR007087 355 375 PS00028 Zinc finger

IPR007087 383 404 PS00028 Zinc finger

IPR007087 744 764 PS00028 Zinc finger

IPR007087 783 803 PS00028 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013069	36	194	PF00651	BTB/POZ
IPR007087	250	272	PF00096	Zinc finger
IPR007087	325	347	PF00096	Zinc finger
IPR007087	381	404	PF00096	Zinc finger
IPR007087	742	764	PF00096	Zinc finger
IPR007087	781	803	PF00096	Zinc finger
HMMSmart	IPR000210	46	203	SM00225	BTB/POZ-like
IPR015880	250	270	SM00355	Zinc finger
IPR015880	325	347	SM00355	Zinc finger
IPR015880	353	375	SM00355	Zinc finger
IPR015880	381	404	SM00355	Zinc finger
IPR015880	742	764	SM00355	Zinc finger
IPR015880	781	803	SM00355	Zinc finger
ProfileScan	IPR000210	46	168	PS50097	BTB/POZ-like
IPR007087	250	278	PS50157	Zinc finger
IPR007087	325	352	PS50157	Zinc finger
IPR007087	353	380	PS50157	Zinc finger
IPR007087	381	404	PS50157	Zinc finger
IPR007087	742	769	PS50157	Zinc finger
IPR007087	781	808	PS50157	Zinc finger
ScanRegExp	IPR007087	327	347	PS00028	Zinc finger
IPR007087	355	375	PS00028	Zinc finger
IPR007087	383	404	PS00028	Zinc finger
IPR007087	744	764	PS00028	Zinc finger
IPR007087	783	803	PS00028	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GCCGCAGCACGCAAAATTTAG

Primer_r
: TTGGCCTACAGAGTTGGACAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 17

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GCCGCAGCACGCAAAATTTAG
Primer_r	: TTGGCCTACAGAGTTGGACAC
PCR product length	: 122 bp
PCR conditions	: 95 °C15 sec64 °C60 sec32 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2559 bp
Genome contig ID	gi51511734r_7203423
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- CAACTCTGTAGGCCAATAAACCAACAAGACAAATG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACTGTGCTCCACAGTGGGATGCCAGGTGCAATTATTTGCGTGGCTGGTG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	17	r	7303423	7323668	4	99.2	Perfect prediction

Gene/Protein Characteristic Table for KIAA1538

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information