HUGE

Gene/Protein Characteristic Table for KIAA1554

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06668
Accession No. :	AB046774
Description :	RING finger protein 213.
HUGO Gene Name :	ring finger protein 213 (RNF213)
Clone Name :	fh17222 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5705 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1741 bp

Genome contig ID gi51511734f_75852096
PolyA signal sequence
(AATATA,-22)
+----*----+----*----+----*----+----
TTGTTTGTACAGAAATATACTGGCCTAGCAGAGGC
Flanking genome sequence
(131540 - 131589)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAATGAATTTTATTTTACTTGTCACACCTGTCTTAATAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 17 f 75952096 75983634 28 99.9 Perfect prediction

Features of the protein sequence	Description

Length: 1320 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAH56308	100.0	hypothetical pr...	Homo sapiens
BAB84856	100.0	FLJ00039 protei...	Homo sapiens
CAE45967	100.0	hypothetical pr...	Homo sapiens
CAH56189	100.0	hypothetical pr...	Homo sapiens
Q63HN8	100.0	RING finger pro...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037825	0.00071	47.6	KIAA1404

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001841 110 148 PF00097 Zinc finger

HMMSmart IPR001841 110 148 SM00184 Zinc finger

ProfileScan IPR001841 110 148 PS50089 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001841	110	148	PF00097	Zinc finger
HMMSmart	IPR001841	110	148	SM00184	Zinc finger
ProfileScan	IPR001841	110	148	PS50089	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GACTCAGCCATGCACACCTTG

Primer_r
: CACAGATGACTAAATGCCAGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 17

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1741 bp
Genome contig ID	gi51511734f_75852096
PolyA signal sequence (AATATA,-22)	+--------+--------+----*----+---- TTGTTTGTACAGAAATATACTGGCCTAGCAGAGGC
Flanking genome sequence (131540 - 131589)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAATGAATTTTATTTTACTTGTCACACCTGTCTTAATAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	17	f	75952096	75983634	28	99.9	Perfect prediction

Primer_f	: GACTCAGCCATGCACACCTTG
Primer_r	: CACAGATGACTAAATGCCAGG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1554

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information