| HUGE |
Gene/Protein Characteristic Table for KIAA1555 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Mapping | |
| Product ID : | ORK01693 |
|---|---|
| Accession No. : | AB046775 |
| Description : | human immunodeficiency virus type I enhancer binding protein 3. |
| HUGO Gene Name : | human immunodeficiency virus type I enhancer binding protein 3 (HIVEP3) |
| Clone Name : | fh17482s2 [Vector Info] |
| Flexi ORF Clone : | pF1KA1555
![]() |
| Source : | Human fetal brain |
| Note : | We replaced fh17482 and fh17482s1, former representative clones for KIAA1555 with fh17482s2. (2003/4/2,2008/8/27) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 8473 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 240 bp Genome contig ID gi89161185r_41648488 PolyA signal sequence
(None) +----*----+----*----+----*----+----
TCACATACATACATTTAAAAAAAAAACAACAACCCFlanking genome sequence
(99981 - 99932) ----+----*----+----*----+----*----+----*----+----*
ACGAGGAGTCTGAGGCTGTGAATAGTTTATGGTTTTGGGGAAAGGCTGAT
Chr f/r start end exon identity class ContigView(URL based/DAS) 1 r 41748469 42156965 8 99.1 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 2414 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
RH mapping information |
Description | |
|---|---|---|
| : 1 |
| : CCR | |
| : AAGGAACCTGAGAAGACTGAG | |
| : AGACATTGCTTTCCTGGCTCG | |
| : 190 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |