HUGE

Gene/Protein Characteristic Table for KIAA1569

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04535
Accession No. :	AB046789
Description :	centrosomal protein 192kDa.
HUGO Gene Name :	centrosomal protein 192kDa (CEP192)
Clone Name :	fh22407 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5140 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 264 bp

Genome contig ID gi51511735f_12947583
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
ATTATGATATTCTGAATAAATATGGAATATATTTT
Flanking genome sequence
(167452 - 167501)
----+----*----+----*----+----*----+----*----+----*
AATGTGGTATATCCAGAAATTTTTCAGTGAGCTTGTCTTTTTCTATGCTG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 18 f 13046679 13115033 26 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 1140 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8TEP8	99.8	Centrosomal pro...	Homo sapiens
EAX01525	99.6	hCG38274, isofo...	Homo sapiens
AAI44482	99.4	CEP192 protein ...	Homo sapiens
BAB84900	99.3	FLJ00145 protei...	Homo sapiens
AAI44481	99.3	CEP192 protein ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TATCAAGGTCCCAGAACAAGG

Primer_r
: ATACTGAGGTCCAAATGGCTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 18

Experimental conditions

Panel name	: CCR
Primer_f	: TATCAAGGTCCCAGAACAAGG
Primer_r	: ATACTGAGGTCCAAATGGCTG
PCR product length	: "166(2.0,250)" bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	264 bp
Genome contig ID	gi51511735f_12947583
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- ATTATGATATTCTGAATAAATATGGAATATATTTT
Flanking genome sequence (167452 - 167501)	----+--------+--------+--------+--------+----* AATGTGGTATATCCAGAAATTTTTCAGTGAGCTTGTCTTTTTCTATGCTG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	18	f	13046679	13115033	26	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA1569

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information