HUGE |
Gene/Protein Characteristic Table for KIAA1571 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK07410 |
---|---|
Accession No. : | AB046791 |
Description : | zinc finger, DBF-type containing 2. |
HUGO Gene Name : | zinc finger, DBF-type containing 2 (ZDBF2) |
Clone Name : | fh22968s1 [Vector Info] |
Source : | Human fetal brain |
Note : | We replaced fh22968, former representative clones for KIAA1571 with fh22968s1. (2003/8/28) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 8172 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 2831 bp Genome contig ID gi89161199f_206779222 PolyA signal sequence
(ATTAAA,-11) +----*----+----*----+----*----+----
TTTGATGTTATCAAGATAAAATTTATTAAACCTTGFlanking genome sequence
(108173 - 108222) ----+----*----+----*----+----*----+----*----+----*
AAATTTGTCTGTTCTCTCTTCATGTTAGAAACTTTTTCTGGGAATACTTG
Chr f/r start end exon identity class ContigView(URL based/DAS) 2 f 206879222 206887393 1 100.0 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1779 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Motif_DB | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
None | - | - | - | - | - |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: AGGACACTGCACCAACTCAAG | |
: CTATGGCTGATTTTCGCTGTC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 2 |
: CCR | |
: AGGACACTGCACCAACTCAAG | |
: CTATGGCTGATTTTCGCTGTC | |
: 181 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |