HUGE

Gene/Protein Characteristic Table for KIAA1575

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00248
Accession No. :	AB046795
Description :	BCL-6 corepressor.
HUGO Gene Name :	BCL6 co-repressor (BCOR)
Clone Name :	fj01374s1 [Vector Info]
Flexi ORF Clone :	pF1KA1575
Source :	Human fetal brain
Note :	We replaced fj01374, former representative clones for KIAA1575 with fj01374s1. (2002/12/27)

Features of the cloned DNA sequence	Description

Length: 3443 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 410 bp

Genome contig ID gi89161218r_39716118
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
GTCTGTGGGATTCATGCAAATTTTTCACCAAAAAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAGGAAAAAAAAAAGAAAAAAGGTTGCTTAAAGGGATAGAGTATGTATT

Features of the protein sequence	Description

Length: 1010 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAG41430	100.0	BCL-6 corepress...	Homo sapiens
AAG41429	99.9	BCL-6 corepress...	Homo sapiens
Q6W2J9	99.9	BCL-6 corepress...	Homo sapiens
AAI14221	100.0	BCOR protein [H...	Homo sapiens
XP_001488971	93.3	BCL6 co-repress...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TGGCCAGTAAGAGAACGTGAG

Primer_r
: ATAGGTAAACGTCATGCAGTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: X

Experimental conditions

Panel name	: RH-map
Primer_f	: TGGCCAGTAAGAGAACGTGAG
Primer_r	: ATAGGTAAACGTCATGCAGTC
PCR product length	: 151 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	410 bp
Genome contig ID	gi89161218r_39716118
PolyA signal sequence (None)	+--------+--------+----*----+---- GTCTGTGGGATTCATGCAAATTTTTCACCAAAAAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAGGAAAAAAAAAAGAAAAAAGGTTGCTTAAAGGGATAGAGTATGTATT

Gene/Protein Characteristic Table for KIAA1575

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information