HUGE

Gene/Protein Characteristic Table for KIAA1599

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00874
Accession No. :	AB046819
Description :	Copine-5.
HUGO Gene Name :	copine V (CPNE5)
Clone Name :	fj09928 [Vector Info]
Flexi ORF Clone :	pF1KSDA1599
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 3897 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1490 bp

Genome contig ID gi89161210r_36716533
PolyA signal sequence
(AGTAAA,-21)
+----*----+----*----+----*----+----
TTGCCTTAAACTGAAGTAAATTTGGTTCTTTTAGT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAGCACGAAGTTTTTCTTTCTTCTCTGAAAAATAGCACTGACGTTGCTG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 6 r 36816533 36915756 21 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 608 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9HCH3	100.0	Copine-5; Copine V.	Homo sapiens
XP_538889	98.5	similar to Copi...	Canis lupus fam...
XP_585264	98.3	similar to Copi...	Bos taurus
Q8JZW4	98.0	Copine-5; Copine V.	Mus musculus
EDL96957	97.8	copine V (predi...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB014536	3.6e-59	52.1	KIAA0636

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR000008 208 220 PR00360 C2 calcium-dependent membrane targeting

IPR000008 263 271 PR00360 C2 calcium-dependent membrane targeting

HMMPfam IPR000008 44 131 PF00168 C2 calcium-dependent membrane targeting

IPR000008 198 283 PF00168 C2 calcium-dependent membrane targeting

IPR010734 362 506 PF07002 Copine

HMMSmart IPR000008 38 146 SM00239 C2 calcium-dependent membrane targeting

IPR000008 176 298 SM00239 C2 calcium-dependent membrane targeting

IPR002035 341 534 SM00327 von Willebrand factor

ProfileScan IPR000008 44 131 PS50004 C2 calcium-dependent membrane targeting

IPR000008 162 283 PS50004 C2 calcium-dependent membrane targeting

IPR002035 343 569 PS50234 von Willebrand factor

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000008	208	220	PR00360	C2 calcium-dependent membrane targeting
IPR000008	263	271	PR00360	C2 calcium-dependent membrane targeting
HMMPfam	IPR000008	44	131	PF00168	C2 calcium-dependent membrane targeting
IPR000008	198	283	PF00168	C2 calcium-dependent membrane targeting
IPR010734	362	506	PF07002	Copine
HMMSmart	IPR000008	38	146	SM00239	C2 calcium-dependent membrane targeting
IPR000008	176	298	SM00239	C2 calcium-dependent membrane targeting
IPR002035	341	534	SM00327	von Willebrand factor
ProfileScan	IPR000008	44	131	PS50004	C2 calcium-dependent membrane targeting
IPR000008	162	283	PS50004	C2 calcium-dependent membrane targeting
IPR002035	343	569	PS50234	von Willebrand factor

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AGGGACCCAGATCAACTTCAC

Primer_r
: CTGTCGTAGTGCTGGATGATC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 6

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1490 bp
Genome contig ID	gi89161210r_36716533
PolyA signal sequence (AGTAAA,-21)	+--------+--------+----*----+---- TTGCCTTAAACTGAAGTAAATTTGGTTCTTTTAGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAGCACGAAGTTTTTCTTTCTTCTCTGAAAAATAGCACTGACGTTGCTG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	6	r	36816533	36915756	21	99.4	Perfect prediction

Primer_f	: AGGGACCCAGATCAACTTCAC
Primer_r	: CTGTCGTAGTGCTGGATGATC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1599

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information