HUGE |
Gene/Protein Characteristic Table for KIAA1623 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK01632 |
---|---|
Accession No. : | AB046843 |
Description : | Transmembrane protein 16H. |
HUGO Gene Name : | |
Clone Name : | fj04650 [Vector Info] |
Flexi ORF Clone : | pF1KSDA1623 |
Source : | Human fetal brain |
Note : | We replaced hk07620, former representative clones for KIAA1623 with fj04650. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4150 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 292 bp Genome contig ID gi42406306r_17195034 PolyA signal sequence
(AATAAA,-22) +----*----+----*----+----*----+----
ACGGCAGAAATGCAATAAAAACTATATTTCAACAGFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
TGCCCGAGGTCAGAGCAGTGGAAAAGGGAGTGGGGGTGGGGGAGTCTGGG
Chr f/r start end exon identity class ContigView(URL based/DAS) 19 r 17295034 17306638 18 99.6 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1236 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: TCCTCAAGTACCTCATCCACG | |
: TGGCGCTCGTGTCTCTTAAAG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 19 |
: RH-map | |
: TTCCTCAAACTGTCCTCCCCC | |
: GGGCATCCAGGCACATAAAGG | |
: 136 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |