HUGE |
Gene/Protein Characteristic Table for KIAA1645 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00260 |
---|---|
Accession No. : | AB051432 |
Description : | Guanine nucleotide-binding protein subunit beta-like protein 1. |
HUGO Gene Name : | |
Clone Name : | fg04139 [Vector Info] |
Flexi ORF Clone : | pF1KA1645 |
Source : | Human fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6645 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 5483 bp Genome contig ID gi89161203r_18050747 PolyA signal sequence
(AATAAA,-19) +----*----+----*----+----*----+----
TATCTCTTGCTACATTAATAAACCACCTCAAACAGFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AGCAGCATAACAGCCATTCTGGGCACGTGGGCTCCGTGGGTCGGGAATTT
Chr f/r start end exon identity class ContigView(URL based/DAS) 22 r 18150747 18222403 8 99.1 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 386 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
RH mapping information |
Description | |
---|---|---|
: 22 |
: genbank | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |