HUGE |
Gene/Protein Characteristic Table for KIAA1649 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00261 |
---|---|
Accession No. : | AB055760 |
Description : | Polymerase delta-interacting protein 3. |
HUGO Gene Name : | polymerase (DNA-directed), delta interacting protein 3 (POLDIP3) |
Clone Name : | fk12339 [Vector Info] |
Flexi ORF Clone : | pF1KA1649
![]() |
Source : | Human fetal brain |
Note : | We replaced hh04042, former representative clones for KIAA1649 with fk12339. (2003/8/28) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3345 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 2069 bp Genome contig ID gi89161203r_41209672 PolyA signal sequence
(AATAAA,-20) +----*----+----*----+----*----+----
ACTTATCCATTTCTGAATAAACATTTGTTATTCCTFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
ACCTTTGAGTTATCTTTTTTTTTTTTTTTTTTTTTTTTTTGAGACAAAGT
Chr f/r start end exon identity class ContigView(URL based/DAS) 22 r 41309672 41340817 9 100.0 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 424 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
RH mapping information |
Description | |
---|---|---|
: 22 |
: genbank | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |