HUGE

Gene/Protein Characteristic Table for KIAA1649

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00261
Accession No. :	AB055760
Description :	Polymerase delta-interacting protein 3.
HUGO Gene Name :	polymerase (DNA-directed), delta interacting protein 3 (POLDIP3)
Clone Name :	fk12339 [Vector Info]
Flexi ORF Clone :	pF1KA1649
Source :	Human fetal brain
Note :	We replaced hh04042, former representative clones for KIAA1649 with fk12339. (2003/8/28)

Features of the cloned DNA sequence	Description

Length: 3345 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2069 bp

Genome contig ID gi89161203r_41209672
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
ACTTATCCATTTCTGAATAAACATTTGTTATTCCT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACCTTTGAGTTATCTTTTTTTTTTTTTTTTTTTTTTTTTTGAGACAAAGT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 22 r 41309672 41340817 9 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 424 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW73266	1.2e-161	100.0	polymerase (DNA...	Homo sapiens
Q9BY77	1.4e-160	100.0	Polymerase delt...	Homo sapiens
XP_001103556	7.2e-160	98.6	similar to DNA ...	Macaca mulatta
AAH01488	5e-159	100.0	POLDIP3 protein...	Homo sapiens
AAI34442	8.4e-153	94.8	Polymerase (DNA...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000504 285 349 PF00076 RNA recognition motif

HMMSmart IPR000504 284 350 SM00360 RNA recognition motif

ProfileScan IPR000504 283 354 PS50102 RNA recognition motif

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000504	285	349	PF00076	RNA recognition motif
HMMSmart	IPR000504	284	350	SM00360	RNA recognition motif
ProfileScan	IPR000504	283	354	PS50102	RNA recognition motif

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 22

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2069 bp
Genome contig ID	gi89161203r_41209672
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- ACTTATCCATTTCTGAATAAACATTTGTTATTCCT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACCTTTGAGTTATCTTTTTTTTTTTTTTTTTTTTTTTTTTGAGACAAAGT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	22	r	41309672	41340817	9	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA1649

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information