| HUGE |
Gene/Protein Characteristic Table for KIAA1658 |
|
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Mapping | |
| Product ID : | ORK05695 |
|---|---|
| Accession No. : | AB051445 |
| Description : | SEC14-like protein 2. |
| HUGO Gene Name : | |
| Clone Name : | fg04185 [Vector Info] |
| Source : | Human fetal brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 5879 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 4403 bp Genome contig ID gi89161203r_29040120 PolyA signal sequence
(None) +----*----+----*----+----*----+----
AAGAAAAAAGAATGCTTTTGTGGGGACCTAAATTTFlanking genome sequence
(99691 - 99642) ----+----*----+----*----+----*----+----*----+----*
AAAAAAGAAAAAAAAAAAACAGAGCTTGAGCTTGTTGCTGCCAGAGCTAA
Chr f/r start end exon identity class ContigView(URL based/DAS) 22 r 29139811 29146669 2 99.1 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 85 aa
No significant homologues
No significant homologues
RH mapping information |
Description | |
|---|---|---|
| : 22 |
| : genbank | |
| : - | |
| : - | |
| : - | |
| : - |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |