HUGE

Gene/Protein Characteristic Table for KIAA1663

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Mapping

Product ID :	ORK00882
Accession No. :	AB051450
Description :	Protein Tob2.
HUGO Gene Name :
Clone Name :	hk01115 [Vector Info]
Flexi ORF Clone :	pF1KSDA1663
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4314 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 2813 bp

Genome contig ID gi89161203r_40059448
PolyA signal sequence
(ATTAAA,-18)
+----*----+----*----+----*----+----
GATTTTTTTAAGTTTGTATTAAAAGCATGATACAT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AATAGCCTTCTGCCTGCTCCTGGCTTGCTTGGTTTCTGGGGTCCCTTTTG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 22 r 40159448 40172732 2 99.1 Perfect prediction

Features of the protein sequence	Description

Length: 347 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q14106	5.7e-120	100.0	Protein Tob2; T...	Homo sapiens
AAV38899	5.7e-120	100.0	transducer of E...	synthetic construct
AAX37067	5.7e-120	100.0	transducer of E...	synthetic construct
CAH89879	3e-119	99.4	hypothetical pr...	Pongo abelii
XP_001502539	1.3e-114	96.2	similar to MGC1...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR002087 32 61 PR00310 Anti-proliferative protein

IPR002087 62 91 PR00310 Anti-proliferative protein

IPR002087 92 121 PR00310 Anti-proliferative protein

HMMPfam IPR002087 4 118 PF07742 Anti-proliferative protein

IPR009818 131 148 PF07145 Ataxin-2

IPR009818 251 268 PF07145 Ataxin-2

HMMSmart IPR002087 4 109 SM00099 Anti-proliferative protein

ScanRegExp IPR002087 43 63 PS00960 Anti-proliferative protein

IPR002087 89 108 PS01203 Anti-proliferative protein

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002087	32	61	PR00310	Anti-proliferative protein
IPR002087	62	91	PR00310	Anti-proliferative protein
IPR002087	92	121	PR00310	Anti-proliferative protein
HMMPfam	IPR002087	4	118	PF07742	Anti-proliferative protein
IPR009818	131	148	PF07145	Ataxin-2
IPR009818	251	268	PF07145	Ataxin-2
HMMSmart	IPR002087	4	109	SM00099	Anti-proliferative protein
ScanRegExp	IPR002087	43	63	PS00960	Anti-proliferative protein
IPR002087	89	108	PS01203	Anti-proliferative protein

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

RH mapping information	Description

Chromosome No.

: 22

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	2813 bp
Genome contig ID	gi89161203r_40059448
PolyA signal sequence (ATTAAA,-18)	+--------+--------+----*----+---- GATTTTTTTAAGTTTGTATTAAAAGCATGATACAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATAGCCTTCTGCCTGCTCCTGGCTTGCTTGGTTTCTGGGGTCCCTTTTG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	22	r	40159448	40172732	2	99.1	Perfect prediction

Gene/Protein Characteristic Table for KIAA1663

Features of the cloned DNA sequence

Features of the protein sequence

RH mapping information