HUGE |
Gene/Protein Characteristic Table for KIAA1665 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00883 |
---|---|
Accession No. : | AB051452 |
Description : | DNA-directed RNA polymerase III subunit RPC8. |
HUGO Gene Name : | polymerase (RNA) III (DNA directed) polypeptide H (22.9kD) (POLR3H) |
Clone Name : | hk01809 [Vector Info] |
Flexi ORF Clone : | pF1KSDA1665 |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4311 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 3453 bp Genome contig ID gi89161203r_40151776 PolyA signal sequence
(AATAAA,-18) +----*----+----*----+----*----+----
CCTTAATAAGCAGCATAAATAAATATCTGACACAGFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
ATTGGAGGCCTCTGGCCACACCAAAAAGGCTTGTTTTTGGTCGGTGCCAA
Chr f/r start end exon identity class ContigView(URL based/DAS) 22 r 40251776 40270294 6 99.1 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 217 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
RH mapping information |
Description | |
---|---|---|
: 22 |
: genbank | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |