HUGE |
Gene/Protein Characteristic Table for KIAA1667 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK05452 |
---|---|
Accession No. : | AB051454 |
Description : | Hermansky-Pudlak syndrome 4 protein. |
HUGO Gene Name : | Hermansky-Pudlak syndrome 4 (HPS4) |
Clone Name : | fg05049 [Vector Info] |
Flexi ORF Clone : | pF1KA1667 |
Source : | Human fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6118 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 1133 bp Genome contig ID gi89161203r_25078066 PolyA signal sequence
(AATAAA,-24) +----*----+----*----+----*----+----
CAAGGGCTAGAAATAAAATAGCCAAAAAATGCTGGFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AGTTCTGAGTAATTAAATGGCAGCATTTTTTTGTGACAAAGGTAAGGGTT
Chr f/r start end exon identity class ContigView(URL based/DAS) 22 r 25178066 25209803 13 99.3 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 505 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Motif_DB | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
None | - | - | - | - | - |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
RH mapping information |
Description | |
---|---|---|
: 22 |
: genbank | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |