HUGE |
Gene/Protein Characteristic Table for KIAA1670 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK04620 |
---|---|
Accession No. : | AB051457 |
Description : | Carnitine O-palmitoyltransferase I, muscle isoform. |
HUGO Gene Name : | |
Clone Name : | hh04251 [Vector Info] |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4906 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 952 bp Genome contig ID gi89161203r_49254164 PolyA signal sequence
(AATAAA,-18) +----*----+----*----+----*----+----
CCCACGTGTTTGCTTGGAATAAATACTTGCCTCAGFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AACCTTCACCTGTTCCCTGGGGCCATTTCTGTTTGTCTGTCTGCTGGAGA
Chr f/r start end exon identity class ContigView(URL based/DAS) 22 r 49354164 49368260 27 99.7 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 598 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
RH mapping information |
Description | |
---|---|---|
: 22 |
: genbank | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |