HUGE |
Gene/Protein Characteristic Table for KIAA1674 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00885 |
---|---|
Accession No. : | AB051461 |
Description : | Leucine-rich repeat-containing protein 27. |
HUGO Gene Name : | leucine rich repeat containing 27 (LRRC27) |
Clone Name : | fg03838 [Vector Info] |
Flexi ORF Clone : | pF1KSDA1674
![]() |
Source : | Human fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6382 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 4684 bp Genome contig ID gi89161187f_133895694 PolyA signal sequence
(None) +----*----+----*----+----*----+----
CTTTGCAGATGAGCCACATAGCCTAGAAATATCTGFlanking genome sequence
(147720 - 147769) ----+----*----+----*----+----*----+----*----+----*
AAAAAAGAAAAAGTTATGTCATGAATGCATAAAATATACAGACCATACAT
Chr f/r start end exon identity class ContigView(URL based/DAS) 10 f 133995694 134043412 11 99.2 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 538 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: CAAGGAGGATGAGCTGCTGTC | |
: AAGATGATGCCTCCAACACCC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 10 |
: GeneBridge 4 | |
: CCACAATGCCACCTGACTGAG | |
: GTGGCCTTTGGTGTAACTCTC | |
: 216 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |