HUGE

Gene/Protein Characteristic Table for KIAA1683

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05702
Accession No. :	AB051470
Description :
HUGO Gene Name :
Clone Name :	fh24307 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5483 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 2984 bp

Genome contig ID gi42406306r_18128909
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
TCTCTGGGTCTAATGAATAAAGTCCTCCACAGCCT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGATCTTGGGTGATGTGTTCTGGGTTAATGGAAGTGGCTTGGGTATAGTG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 19 r 18228909 18234428 6 97.8 Internal No-hit

Features of the protein sequence	Description

Length: 832 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW84683	5.9e-166	97.8	hCG2001480 [Hom...	Homo sapiens
AAN09586	2.6e-22	18.2	CG32602 [Drosop...	Drosophila mela...
EED95573	1.1e-21	34.6	predicted prote...	Thalassiosira p...
EDY74106	3.9e-20	27.0	GA28568 [Drosop...	Drosophila pseu...
AAW51128	7.1e-20	30.1	minus agglutini...	Chlamydomonas i...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR008165 361 445 PD003992 Protein of unknown function GLTT

ScanRegExp IPR000005 638 682 PS00041 Helix-turn-helix

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR008165	361	445	PD003992	Protein of unknown function GLTT
ScanRegExp	IPR000005	638	682	PS00041	Helix-turn-helix

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AGCAAATGGCAGCGAAGATAG

Primer_r
: TTAGACCCAGAGAGCCATGAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 19

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	2984 bp
Genome contig ID	gi42406306r_18128909
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- TCTCTGGGTCTAATGAATAAAGTCCTCCACAGCCT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGATCTTGGGTGATGTGTTCTGGGTTAATGGAAGTGGCTTGGGTATAGTG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	19	r	18228909	18234428	6	97.8	Internal No-hit

Primer_f	: AGCAAATGGCAGCGAAGATAG
Primer_r	: TTAGACCCAGAGAGCCATGAG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1683

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information