HUGE

Gene/Protein Characteristic Table for KIAA1692

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00267
Accession No. :	AB051479
Description :	ventricular zone expressed PH domain homolog 1.
HUGO Gene Name :	ventricular zone expressed PH domain homolog 1 (zebrafish) (VEPH1)
Clone Name :	fj05607 [Vector Info]
Flexi ORF Clone :	pF1KA1692
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 4119 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO
Ensembl ContigView (Add our DAS server as a DAS source)
Content-type: text/html ¥¨¥é¡¼¡ª

fj05607 ¤Î¾ðÊó¤¬¥Ç¡¼¥¿¥Ù¡¼¥¹¤Ë¤¢¤ê¤Þ¤»¤ó¤Ç¤·¤¿¡£

¤â¤É¤ë

Features of the protein sequence	Description

Length: 855 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q14D04	100.0	Ventricular zon...	Homo sapiens
AAI01661	99.9	Ventricular zon...	Homo sapiens
CAD28465	99.9	hypothetical pr...	Homo sapiens
BAB55243	99.8	unnamed protein...	Homo sapiens
XP_001152820	99.4	hypothetical pr...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001849 739 841 PF00169 Pleckstrin-like

HMMSmart IPR001849 739 843 SM00233 Pleckstrin-like

ProfileScan IPR001849 738 841 PS50003 Pleckstrin-like

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001849	739	841	PF00169	Pleckstrin-like
HMMSmart	IPR001849	739	843	SM00233	Pleckstrin-like
ProfileScan	IPR001849	738	841	PS50003	Pleckstrin-like

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TGTAAATCAAGATGGCCAGCC

Primer_r
: GAGTTCTATTGGGCAGTCGTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 3

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Primer_f	: TGTAAATCAAGATGGCCAGCC
Primer_r	: GAGTTCTATTGGGCAGTCGTC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1692

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information