HUGE |
Gene/Protein Characteristic Table for KIAA1699 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK04925 |
---|---|
Accession No. : | AB051486 |
Description : | Exocyst complex component 4. |
HUGO Gene Name : | exocyst complex component 4 (EXOC4) |
Clone Name : | fj15278 [Vector Info] |
Source : | Human fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4132 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1230 bp Genome contig ID gi89161213f_132488421 PolyA signal sequence
(ATTAAA,-24) +----*----+----*----+----*----+----
AAAAATGGAGAATTAAAAAGTGTTTTGAGAAGCTTFlanking genome sequence
(912632 - 912681) ----+----*----+----*----+----*----+----*----+----*
AAATGTTTCATGTTATTTTTCTTGTGTTCTTTATTCAGCAAATATTCCCC
Chr f/r start end exon identity class ContigView(URL based/DAS) 7 f 132588421 133401051 18 99.6 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 966 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: AAGTCTTTTGATCCCAGTCCG | |
: TTGCCTTTCATTCCTCCATAG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 7 |
: unigene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |