| HUGE |
Gene/Protein Characteristic Table for KIAA1719 |
|
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK00898 |
|---|---|
| Accession No. : | AB051506 |
| Description : | Glutamate receptor-interacting protein 2. |
| HUGO Gene Name : | glutamate receptor interacting protein 2 (GRIP2) |
| Clone Name : | pf00330s1 [Vector Info] |
| Flexi ORF Clone : | pF1KSDA1719
|
| Source : | Human brain (hippocampus) |
| Note : | We replaced pf00330, former representative clones for KIAA1719 with pf00330s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 7706 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 4553 bp Genome contig ID gi89161205r_14405623 PolyA signal sequence
(AATACA,-21)
AAGGATCTTGTTCAAATACAAATGTTCCTCCTCAGFlanking genome sequence
(100000 - 99951)
AAAAGTCTCTTGTTGGTTGATTTTTTTTTTATAAAAGTTTAAAATATCTT
Chr f/r start end exon identity class ContigView(URL based/DAS) 3 r 14505623 14556840 24 99.3 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 1050 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
|---|---|---|
| RT-PCR-ELISA | Description |
|---|
Experimental conditions
| : CCTGCCCTAGTTGGAGTGACA | |
| : GTGCTCCCTACATCTTCGACC | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 3 |
| : CCR | |
| : CCTGCCCTAGTTGGAGTGACA | |
| : GTGCTCCCTACATCTTCGACC | |
| : 177 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage 
| |
