HUGE |
Gene/Protein Characteristic Table for KIAA1721 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00900 |
---|---|
Accession No. : | AB051508 |
Description : | Exportin-4. |
HUGO Gene Name : | exportin 4 (XPO4) |
Clone Name : | pf00531 [Vector Info] |
Flexi ORF Clone : | pF1KSDA1721
![]() |
Source : | Human brain (hippocampus) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 8047 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 4592 bp Genome contig ID gi51511729r_20151311 PolyA signal sequence
(ATTAAA,-19) +----*----+----*----+----*----+----
TTTTAAATTTATAAATATTAAAATTTTAAACTTACFlanking genome sequence
(99958 - 99909) ----+----*----+----*----+----*----+----*----+----*
ACTAAGACTTTTCAGTTTTATTTAAAGACCCAGGGATGAGTGTACTGTTT
Chr f/r start end exon identity class ContigView(URL based/DAS) 13 r 20251269 20374876 23 99.4 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1150 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Motif_DB | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
None | - | - | - | - | - |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: AACAGTTACTTGCTTCACCGG | |
: TTTCTGGAGGTATTAGCGGAG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 13 |
: unigene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |