| HUGE |
Gene/Protein Characteristic Table for KIAA1733 |
|
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK00904 |
|---|---|
| Accession No. : | AB051520 |
| Description : | Phosphatase and actin regulator 1. |
| HUGO Gene Name : | phosphatase and actin regulator 1 (PHACTR1) |
| Clone Name : | ph00321 [Vector Info] |
| Flexi ORF Clone : | pF1KSDA1733
|
| Source : | Human brain (hippocampus) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 4784 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 3200 bp Genome contig ID gi89161210f_12725879 PolyA signal sequence
(None)
GTTTAATGGGCTTTTATTCAAGAGAAATTTGCATTFlanking genome sequence
(658457 - 658506)
AAAAAAAAAAAAAACCTCTCCGGGAGGGAGATAGGATCTCTAAATCCAAA
Chr f/r start end exon identity class ContigView(URL based/DAS) 6 f 12825879 13384334 10 99.3 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 509 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
|---|---|---|
| RT-PCR-ELISA | Description |
|---|
Experimental conditions
| : TCCAGAAATAAGACAAGTGCC | |
| : CTGGTGTATAATGAGCTGTCG | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 6 |
| : unigene | |
| : - | |
| : - | |
| : - | |
| : - |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage 
| |
