HUGE |
Gene/Protein Characteristic Table for KIAA1742 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK04779 |
---|---|
Accession No. : | AB051529 |
Description : | dispatched B. |
HUGO Gene Name : | dispatched homolog 2 (Drosophila) (DISP2) |
Clone Name : | pj01304s1 [Vector Info] |
Source : | Human brain (hippocampus) |
Note : | We replaced pj01304, former representative clones for KIAA1742 with pj01304s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5035 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 737 bp Genome contig ID gi51511731f_38337773 PolyA signal sequence
(AATAAA,-31) +----*----+----*----+----*----+----
TGTTAATAAACAGTAATAATCCTTTCCATCTCTGCFlanking genome sequence
(112777 - 112826) ----+----*----+----*----+----*----+----*----+----*
ACATTTTAGTCTCCTTGGAATCTATCTCACTACTTCACTACAGGGTAGCC
Chr f/r start end exon identity class ContigView(URL based/DAS) 15 f 38437726 38450548 8 98.9 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1301 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: TACTGCATCTCCTATCACCTG | |
: AAGAAACAGCAGAGAGATTGG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 15 |
: unigene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |