HUGE

Gene/Protein Characteristic Table for KIAA1758

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :
Accession No. :	AB051545
Description :	Cortactin-binding protein 2.
HUGO Gene Name :	cortactin binding protein 2 (CTTNBP2)
Clone Name :	fh20539 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5710 bp
Physical map
Restriction map
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
Comparison between the cloned and the revised DNA sequences.
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq. revised DNA seq.
Warning for N-terminal truncation:
YES YES

Warning for coding interruption:
YES NO

Integrity of 3' end

Length of 3'UTR 883 bp

Genome contig ID gi89161213r_117037944
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
GATGCTTTGACACTGAATAAAATATTGATTTCATG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAATCATTTTGCTGTACTTTTTATCTATAGCTCTTTGTAGTCTCTGTAAC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 7 r 117137944 117300703 23 99.8 Perfect prediction

Features of the protein sequence	Description

Length: 1662 aa
This protein sequence is predicted from the revised DNA sequence

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8WZ74	100.0	Cortactin-bindi...	Homo sapiens
XP_519331	99.4	cortactin bindi...	Pan troglodytes
Q2IBF7	99.4	Cortactin-bindi...	Gorilla gorilla...
Q2IBE6	98.6	Cortactin-bindi...	Pongo abelii
Q07DX4	98.3	Cortactin-bindi...	Nomascus leucogenys

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037854	6.6e-14	40.4	KIAA1433

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR002110 809 821 PR01415 Ankyrin

IPR002110 821 833 PR01415 Ankyrin

HMMPfam IPR002110 711 741 PF00023 Ankyrin

IPR002110 742 774 PF00023 Ankyrin

IPR002110 775 807 PF00023 Ankyrin

IPR002110 808 840 PF00023 Ankyrin

IPR002110 841 864 PF00023 Ankyrin

IPR002110 911 944 PF00023 Ankyrin

HMMSmart IPR002110 708 738 SM00248 Ankyrin

IPR002110 742 771 SM00248 Ankyrin

IPR002110 775 804 SM00248 Ankyrin

IPR002110 808 837 SM00248 Ankyrin

IPR002110 841 875 SM00248 Ankyrin

IPR002110 911 941 SM00248 Ankyrin

ProfileScan IPR002110 708 862 PS50297 Ankyrin

IPR002110 742 774 PS50088 Ankyrin

IPR002110 775 807 PS50088 Ankyrin

IPR002110 808 840 PS50088 Ankyrin

IPR002110 841 862 PS50088 Ankyrin

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002110	809	821	PR01415	Ankyrin
IPR002110	821	833	PR01415	Ankyrin
HMMPfam	IPR002110	711	741	PF00023	Ankyrin
IPR002110	742	774	PF00023	Ankyrin
IPR002110	775	807	PF00023	Ankyrin
IPR002110	808	840	PF00023	Ankyrin
IPR002110	841	864	PF00023	Ankyrin
IPR002110	911	944	PF00023	Ankyrin
HMMSmart	IPR002110	708	738	SM00248	Ankyrin
IPR002110	742	771	SM00248	Ankyrin
IPR002110	775	804	SM00248	Ankyrin
IPR002110	808	837	SM00248	Ankyrin
IPR002110	841	875	SM00248	Ankyrin
IPR002110	911	941	SM00248	Ankyrin
ProfileScan	IPR002110	708	862	PS50297	Ankyrin
IPR002110	742	774	PS50088	Ankyrin
IPR002110	775	807	PS50088	Ankyrin
IPR002110	808	840	PS50088	Ankyrin
IPR002110	841	862	PS50088	Ankyrin

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CAGATGATGCAGAACTACCTC

Primer_r
: AGCGCTACTAATGAACAGGTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 7

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.	revised DNA seq.
Warning for N-terminal truncation:	YES	YES
Warning for coding interruption:	YES	NO

Length of 3'UTR	883 bp
Genome contig ID	gi89161213r_117037944
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- GATGCTTTGACACTGAATAAAATATTGATTTCATG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAATCATTTTGCTGTACTTTTTATCTATAGCTCTTTGTAGTCTCTGTAAC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	7	r	117137944	117300703	23	99.8	Perfect prediction

Primer_f	: CAGATGATGCAGAACTACCTC
Primer_r	: AGCGCTACTAATGAACAGGTC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1758

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information