HUGE

Gene/Protein Characteristic Table for KIAA1784

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05711
Accession No. :	AB058687
Description :	BTB/POZ domain-containing protein 12.
HUGO Gene Name :	BTB (POZ) domain containing 12 (BTBD12)
Clone Name :	fh08226 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5027 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1521 bp

Genome contig ID gi51511732r_3471220
PolyA signal sequence
(AATACA,-20)
+----*----+----*----+----*----+----
TCCTCGTCTGTTTCAAATACAGTGCAGTCAGTTTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATATGATGTGCAATAAACCAAAAAGGCTTTATTAAAATCTGGCTGCCACA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 16 r 3571220 3584602 7 99.2 Both No-hit

Features of the protein sequence	Description

Length: 1167 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW85346	99.7	BTB (POZ) domai...	Homo sapiens
EAW85345	99.7	BTB (POZ) domai...	Homo sapiens
EAW85347	99.7	BTB (POZ) domai...	Homo sapiens
Q8IY92	99.7	BTB/POZ domain-...	Homo sapiens
XP_001167578	98.1	BTB (POZ) domai...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR013069 14 127 PF00651 BTB/POZ

HMMSmart IPR000210 24 127 SM00225 BTB/POZ-like

ProfileScan IPR000210 24 97 PS50097 BTB/POZ-like

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013069	14	127	PF00651	BTB/POZ
HMMSmart	IPR000210	24	127	SM00225	BTB/POZ-like
ProfileScan	IPR000210	24	97	PS50097	BTB/POZ-like

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GTCATTGTTACCAGCAGTCTC

Primer_r
: ACAGACGAGGACATTCACAAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 16

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1521 bp
Genome contig ID	gi51511732r_3471220
PolyA signal sequence (AATACA,-20)	+--------+--------+----*----+---- TCCTCGTCTGTTTCAAATACAGTGCAGTCAGTTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATATGATGTGCAATAAACCAAAAAGGCTTTATTAAAATCTGGCTGCCACA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	16	r	3571220	3584602	7	99.2	Both No-hit

Primer_f	: GTCATTGTTACCAGCAGTCTC
Primer_r	: ACAGACGAGGACATTCACAAG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1784

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information